TutorialsPerl regular expressions tutorialDaftar Isi NAMEperlretut - Perl regular expressions tutorial DESCRIPTIONThis page provides a basic tutorial on understanding, creating andusing regular expressions in Perl. It serves as a complement to thereference page on regular expressions perlre. Regular expressionsare an integral part of the m// , s/// , qr// and split operators and so this tutorial also overlaps withRegexp Quote-Like Operators in perlop and split. Perl is widely renowned for excellence in text processing, and regularexpressions are one of the big factors behind this fame. Perl regularexpressions display an efficiency and flexibility unknown in mostother computer languages. Mastering even the basics of regularexpressions will allow you to manipulate text with surprising ease. What is a regular expression? A regular expression is simply a stringthat describes a pattern. Patterns are in common use these days;examples are the patterns typed into a search engine to find web pagesand the patterns used to list files in a directory, e.g., ls *.txt or dir *.* . In Perl, the patterns described by regular expressionsare used to search strings, extract desired parts of strings, and todo search and replace operations. Regular expressions have the undeserved reputation of being abstractand difficult to understand. Regular expressions are constructed usingsimple concepts like conditionals and loops and are no more difficultto understand than the corresponding if conditionals and while loops in the Perl language itself. In fact, the main challenge inlearning regular expressions is just getting used to the tersenotation used to express these concepts. This tutorial flattens the learning curve by discussing regularexpression concepts, along with their notation, one at a time and withmany examples. The first part of the tutorial will progress from thesimplest word searches to the basic regular expression concepts. Ifyou master the first part, you will have all the tools needed to solveabout 98% of your needs. The second part of the tutorial is for thosecomfortable with the basics and hungry for more power tools. Itdiscusses the more advanced regular expression operators andintroduces the latest cutting-edge innovations. A note: to save time, 'regular expression' is often abbreviated asregexp or regex. Regexp is a more natural abbreviation than regex, butis harder to pronounce. The Perl pod documentation is evenly split onregexp vs regex; in Perl, there is more than one way to abbreviate it.We'll use regexp in this tutorial. Part 1: The basicsSimple word matchingThe simplest regexp is simply a word, or more generally, a string ofcharacters. A regexp consisting of a word matches any string thatcontains that word: - "Hello World" =~ /World/; # matches
What is this Perl statement all about? "Hello World" is a simpledouble-quoted string. World is the regular expression and the// enclosing /World/ tells Perl to search a string for a match.The operator =~ associates the string with the regexp match andproduces a true value if the regexp matched, or false if the regexpdid not match. In our case, World matches the second word in"Hello World" , so the expression is true. Expressions like thisare useful in conditionals: - if ("Hello World" =~ /World/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
There are useful variations on this theme. The sense of the match canbe reversed by using the !~ operator: - if ("Hello World" !~ /World/) {
- print "It doesn't match\n";
- }
- else {
- print "It matches\n";
- }
The literal string in the regexp can be replaced by a variable: - $greeting = "World";
- if ("Hello World" =~ /$greeting/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
If you're matching against the special default variable $_ , the$_ =~ part can be omitted: - $_ = "Hello World";
- if (/World/) {
- print "It matches\n";
- }
- else {
- print "It doesn't match\n";
- }
And finally, the // default delimiters for a match can be changedto arbitrary delimiters by putting an 'm' out front: - "Hello World" =~ m!World!; # matches, delimited by '!'
- "Hello World" =~ m{World}; # matches, note the matching '{}'
- "/usr/bin/perl" =~ m"/perl"; # matches after '/usr/bin',
- # '/' becomes an ordinary char
/World/ , m!World! , and m{World} all represent thesame thing. When, e.g., the quote (" ) is used as a delimiter, the forwardslash '/' becomes an ordinary character and can be used in this regexpwithout trouble.
Let's consider how different regexps would match "Hello World" : - "Hello World" =~ /world/; # doesn't match
- "Hello World" =~ /o W/; # matches
- "Hello World" =~ /oW/; # doesn't match
- "Hello World" =~ /World /; # doesn't match
The first regexp world doesn't match because regexps arecase-sensitive. The second regexp matches because the substring'o W' occurs in the string "Hello World" . The spacecharacter ' ' is treated like any other character in a regexp and isneeded to match in this case. The lack of a space character is thereason the third regexp 'oW' doesn't match. The fourth regexp'World ' doesn't match because there is a space at the end of theregexp, but not at the end of the string. The lesson here is thatregexps must match a part of the string exactly in order for thestatement to be true. If a regexp matches in more than one place in the string, Perl willalways match at the earliest possible point in the string: - "Hello World" =~ /o/; # matches 'o' in 'Hello'
- "That hat is red" =~ /hat/; # matches 'hat' in 'That'
With respect to character matching, there are a few more points youneed to know about. First of all, not all characters can be used 'asis' in a match. Some characters, called metacharacters, are reservedfor use in regexp notation. The metacharacters are - {}[]()^$.|*+?\
The significance of each of these will be explainedin the rest of the tutorial, but for now, it is important only to knowthat a metacharacter can be matched by putting a backslash before it: - "2+2=4" =~ /2+2/; # doesn't match, + is a metacharacter
- "2+2=4" =~ /2\+2/; # matches, \+ is treated like an ordinary +
- "The interval is [0,1)." =~ /[0,1)./ # is a syntax error!
- "The interval is [0,1)." =~ /\[0,1\)\./ # matches
- "#!/usr/bin/perl" =~ /#!\/usr\/bin\/perl/; # matches
In the last regexp, the forward slash '/' is also backslashed,because it is used to delimit the regexp. This can lead to LTS(leaning toothpick syndrome), however, and it is often more readableto change delimiters. - "#!/usr/bin/perl" =~ m!#\!/usr/bin/perl!; # easier to read
The backslash character '\' is a metacharacter itself and needs tobe backslashed: - 'C:\WIN32' =~ /C:\WIN/; # matches
In addition to the metacharacters, there are some ASCII characterswhich don't have printable character equivalents and are insteadrepresented by escape sequences. Common examples are \t for atab, \n for a newline, \r for a carriage return and \a for abell (or alert). If your string is better thought of as a sequence of arbitrarybytes, the octal escape sequence, e.g., \033 , or hexadecimal escapesequence, e.g., \x1B may be a more natural representation for yourbytes. Here are some examples of escapes: - "1000\t2000" =~ m(0\t2) # matches
- "1000\n2000" =~ /0\n20/ # matches
- "1000\t2000" =~ /\000\t2/ # doesn't match, "0" ne "\000"
- "cat" =~ /\o{143}\x61\x74/ # matches in ASCII, but a weird way
- # to spell cat
If you've been around Perl a while, all this talk of escape sequencesmay seem familiar. Similar escape sequences are used in double-quotedstrings and in fact the regexps in Perl are mostly treated asdouble-quoted strings. This means that variables can be used inregexps as well. Just like double-quoted strings, the values of thevariables in the regexp will be substituted in before the regexp isevaluated for matching purposes. So we have: - $foo = 'house';
- 'housecat' =~ /$foo/; # matches
- 'cathouse' =~ /cat$foo/; # matches
- 'housecat' =~ /${foo}cat/; # matches
So far, so good. With the knowledge above you can already performsearches with just about any literal string regexp you can dream up.Here is a very simple emulation of the Unix grep program: - % cat > simple_grep
- #!/usr/bin/perl
- $regexp = shift;
- while (<>) {
- print if /$regexp/;
- }
- ^D
- % chmod +x simple_grep
- % simple_grep abba /usr/dict/words
- Babbage
- cabbage
- cabbages
- sabbath
- Sabbathize
- Sabbathizes
- sabbatical
- scabbard
- scabbards
This program is easy to understand. #!/usr/bin/perl is the standardway to invoke a perl program from the shell.$regexp = shift; saves the first command line argument as theregexp to be used, leaving the rest of the command line arguments tobe treated as files. while (<>) loops over all the lines inall the files. For each line, print if /$regexp/; prints theline if the regexp matches the line. In this line, both print and/$regexp/ use the default variable $_ implicitly. With all of the regexps above, if the regexp matched anywhere in thestring, it was considered a match. Sometimes, however, we'd like tospecify where in the string the regexp should try to match. To dothis, we would use the anchor metacharacters ^ and $ . Theanchor ^ means match at the beginning of the string and the anchor$ means match at the end of the string, or before a newline at theend of the string. Here is how they are used: - "housekeeper" =~ /keeper/; # matches
- "housekeeper" =~ /^keeper/; # doesn't match
- "housekeeper" =~ /keeper$/; # matches
- "housekeeper\n" =~ /keeper$/; # matches
The second regexp doesn't match because ^ constrains keeper tomatch only at the beginning of the string, but "housekeeper" haskeeper starting in the middle. The third regexp does match, since the$ constrains keeper to match only at the end of the string. When both ^ and $ are used at the same time, the regexp has tomatch both the beginning and the end of the string, i.e., the regexpmatches the whole string. Consider - "keeper" =~ /^keep$/; # doesn't match
- "keeper" =~ /^keeper$/; # matches
- "" =~ /^$/; # ^$ matches an empty string
The first regexp doesn't match because the string has more to it thankeep . Since the second regexp is exactly the string, itmatches. Using both ^ and $ in a regexp forces the completestring to match, so it gives you complete control over which stringsmatch and which don't. Suppose you are looking for a fellow namedbert, off in a string by himself: - "dogbert" =~ /bert/; # matches, but not what you want
- "dilbert" =~ /^bert/; # doesn't match, but ..
- "bertram" =~ /^bert/; # matches, so still not good enough
- "bertram" =~ /^bert$/; # doesn't match, good
- "dilbert" =~ /^bert$/; # doesn't match, good
- "bert" =~ /^bert$/; # matches, perfect
Of course, in the case of a literal string, one could just as easilyuse the string comparison $string eq 'bert' and it would bemore efficient. The ^...$ regexp really becomes useful when weadd in the more powerful regexp tools below. Using character classesAlthough one can already do quite a lot with the literal stringregexps above, we've only scratched the surface of regular expressiontechnology. In this and subsequent sections we will introduce regexpconcepts (and associated metacharacter notations) that will allow aregexp to represent not just a single character sequence, but a wholeclass of them. One such concept is that of a character class. A character classallows a set of possible characters, rather than just a singlecharacter, to match at a particular point in a regexp. Characterclasses are denoted by brackets [...] , with the set of charactersto be possibly matched inside. Here are some examples: - /cat/; # matches 'cat'
- /[bcr]at/; # matches 'bat, 'cat', or 'rat'
- /item[0123456789]/; # matches 'item0' or ... or 'item9'
- "abc" =~ /[cab]/; # matches 'a'
In the last statement, even though 'c' is the first character inthe class, 'a' matches because the first character position in thestring is the earliest point at which the regexp can match. - /[yY][eE][sS]/; # match 'yes' in a case-insensitive way
- # 'yes', 'Yes', 'YES', etc.
This regexp displays a common task: perform a case-insensitivematch. Perl provides a way of avoiding all those brackets by simplyappending an 'i' to the end of the match. Then /[yY][eE][sS]/; can be rewritten as /yes/i; . The 'i' stands forcase-insensitive and is an example of a modifier of the matchingoperation. We will meet other modifiers later in the tutorial. We saw in the section above that there were ordinary characters, whichrepresented themselves, and special characters, which needed abackslash \ to represent themselves. The same is true in acharacter class, but the sets of ordinary and special charactersinside a character class are different than those outside a characterclass. The special characters for a character class are -]\^$ (andthe pattern delimiter, whatever it is).] is special because it denotes the end of a character class. $ isspecial because it denotes a scalar variable. \ is special becauseit is used in escape sequences, just like above. Here is how thespecial characters ]$\ are handled: - /[\]c]def/; # matches ']def' or 'cdef'
- $x = 'bcr';
- /[$x]at/; # matches 'bat', 'cat', or 'rat'
- /[\$x]at/; # matches '$at' or 'xat'
- /[\$x]at/; # matches '\at', 'bat, 'cat', or 'rat'
The last two are a little tricky. In [\$x] , the backslash protectsthe dollar sign, so the character class has two members $ and x .In [\$x] , the backslash is protected, so $x is treated as avariable and substituted in double quote fashion. The special character '-' acts as a range operator within characterclasses, so that a contiguous set of characters can be written as arange. With ranges, the unwieldy [0123456789] and [abc...xyz] become the svelte [0-9] and [a-z] . Some examples are - /item[0-9]/; # matches 'item0' or ... or 'item9'
- /[0-9bx-z]aa/; # matches '0aa', ..., '9aa',
- # 'baa', 'xaa', 'yaa', or 'zaa'
- /[0-9a-fA-F]/; # matches a hexadecimal digit
- /[0-9a-zA-Z_]/; # matches a "word" character,
- # like those in a Perl variable name
If '-' is the first or last character in a character class, it istreated as an ordinary character; [-ab] , [ab-] and [a\-b] areall equivalent. The special character ^ in the first position of a character classdenotes a negated character class, which matches any character butthose in the brackets. Both [...] and [^...] must match acharacter, or the match fails. Then - /[^a]at/; # doesn't match 'aat' or 'at', but matches
- # all other 'bat', 'cat, '0at', '%at', etc.
- /[^0-9]/; # matches a non-numeric character
- /[a^]at/; # matches 'aat' or '^at' here '^' is ordinary
Now, even [0-9] can be a bother to write multiple times, so in theinterest of saving keystrokes and making regexps more readable, Perlhas several abbreviations for common character classes, as shown below.Since the introduction of Unicode, unless the //a modifier is ineffect, these character classes match more than just a few characters inthe ASCII range. \d matches a digit, not just [0-9] but also digits from non-roman scripts \s matches a whitespace character, the set [\ \t\r\n\f] and others \w matches a word character (alphanumeric or _), not just [0-9a-zA-Z_]but also digits and characters from non-roman scripts \D is a negated \d; it represents any other character than a digit, or [^\d] \S is a negated \s; it represents any non-whitespace character [^\s] \W is a negated \w; it represents any non-word character [^\w] The period '.' matches any character but "\n" (unless the modifier //s isin effect, as explained below). \N, like the period, matches any character but "\n", but it does soregardless of whether the modifier //s is in effect.
The //a modifier, available starting in Perl 5.14, is used torestrict the matches of \d, \s, and \w to just those in the ASCII range.It is useful to keep your program from being needlessly exposed to fullUnicode (and its accompanying security considerations) when all you wantis to process English-like text. (The "a" may be doubled, //aa , toprovide even more restrictions, preventing case-insensitive matching ofASCII with non-ASCII characters; otherwise a Unicode "Kelvin Sign"would caselessly match a "k" or "K".) The \d\s\w\D\S\W abbreviations can be used both inside and outsideof character classes. Here are some in use: - /\d\d:\d\d:\d\d/; # matches a hh:mm:ss time format
- /[\d\s]/; # matches any digit or whitespace character
- /\w\W\w/; # matches a word char, followed by a
- # non-word char, followed by a word char
- /..rt/; # matches any two chars, followed by 'rt'
- /end\./; # matches 'end.'
- /end[.]/; # same thing, matches 'end.'
Because a period is a metacharacter, it needs to be escaped to matchas an ordinary period. Because, for example, \d and \w are setsof characters, it is incorrect to think of [^\d\w] as [\D\W] ; infact [^\d\w] is the same as [^\w] , which is the same as[\W] . Think DeMorgan's laws. An anchor useful in basic regexps is the word anchor\b . This matches a boundary between a word character and a non-wordcharacter \w\W or \W\w : - $x = "Housecat catenates house and cat";
- $x =~ /cat/; # matches cat in 'housecat'
- $x =~ /\bcat/; # matches cat in 'catenates'
- $x =~ /cat\b/; # matches cat in 'housecat'
- $x =~ /\bcat\b/; # matches 'cat' at end of string
Note in the last example, the end of the string is considered a wordboundary. You might wonder why '.' matches everything but "\n" - why notevery character? The reason is that often one is matching againstlines and would like to ignore the newline characters. For instance,while the string "\n" represents one line, we would like to thinkof it as empty. Then - "" =~ /^$/; # matches
- "\n" =~ /^$/; # matches, $ anchors before "\n"
- "" =~ /./; # doesn't match; it needs a char
- "" =~ /^.$/; # doesn't match; it needs a char
- "\n" =~ /^.$/; # doesn't match; it needs a char other than "\n"
- "a" =~ /^.$/; # matches
- "a\n" =~ /^.$/; # matches, $ anchors before "\n"
This behavior is convenient, because we usually want to ignorenewlines when we count and match characters in a line. Sometimes,however, we want to keep track of newlines. We might even want ^ and $ to anchor at the beginning and end of lines within thestring, rather than just the beginning and end of the string. Perlallows us to choose between ignoring and paying attention to newlinesby using the //s and //m modifiers. //s and //m stand forsingle line and multi-line and they determine whether a string is tobe treated as one continuous string, or as a set of lines. The twomodifiers affect two aspects of how the regexp is interpreted: 1) howthe '.' character class is defined, and 2) where the anchors ^ and $ are able to match. Here are the four possible combinations: no modifiers (//): Default behavior. '.' matches any characterexcept "\n" . ^ matches only at the beginning of the string and$ matches only at the end or before a newline at the end. s modifier (//s): Treat string as a single long line. '.' matchesany character, even "\n" . ^ matches only at the beginning ofthe string and $ matches only at the end or before a newline at theend. m modifier (//m): Treat string as a set of multiple lines. '.' matches any character except "\n" . ^ and $ are able to matchat the start or end of any line within the string. both s and m modifiers (//sm): Treat string as a single long line, butdetect multiple lines. '.' matches any character, even"\n" . ^ and $ , however, are able to match at the start or endof any line within the string.
Here are examples of //s and //m in action: - $x = "There once was a girl\nWho programmed in Perl\n";
- $x =~ /^Who/; # doesn't match, "Who" not at start of string
- $x =~ /^Who/s; # doesn't match, "Who" not at start of string
- $x =~ /^Who/m; # matches, "Who" at start of second line
- $x =~ /^Who/sm; # matches, "Who" at start of second line
- $x =~ /girl.Who/; # doesn't match, "." doesn't match "\n"
- $x =~ /girl.Who/s; # matches, "." matches "\n"
- $x =~ /girl.Who/m; # doesn't match, "." doesn't match "\n"
- $x =~ /girl.Who/sm; # matches, "." matches "\n"
Most of the time, the default behavior is what is wanted, but //s and//m are occasionally very useful. If //m is being used, the startof the string can still be matched with \A and the end of the stringcan still be matched with the anchors \Z (matches both the end andthe newline before, like $ ), and \z (matches only the end): - $x =~ /^Who/m; # matches, "Who" at start of second line
- $x =~ /\AWho/m; # doesn't match, "Who" is not at start of string
- $x =~ /girl$/m; # matches, "girl" at end of first line
- $x =~ /girl\Z/m; # doesn't match, "girl" is not at end of string
- $x =~ /Perl\Z/m; # matches, "Perl" is at newline before end
- $x =~ /Perl\z/m; # doesn't match, "Perl" is not at end of string
We now know how to create choices among classes of characters in aregexp. What about choices among words or character strings? Suchchoices are described in the next section. Matching this or thatSometimes we would like our regexp to be able to match differentpossible words or character strings. This is accomplished by usingthe alternation metacharacter | . To match dog or cat , weform the regexp dog|cat . As before, Perl will try to match theregexp at the earliest possible point in the string. At eachcharacter position, Perl will first try to match the firstalternative, dog . If dog doesn't match, Perl will then try thenext alternative, cat . If cat doesn't match either, then thematch fails and Perl moves to the next position in the string. Someexamples: - "cats and dogs" =~ /cat|dog|bird/; # matches "cat"
- "cats and dogs" =~ /dog|cat|bird/; # matches "cat"
Even though dog is the first alternative in the second regexp,cat is able to match earlier in the string. - "cats" =~ /c|ca|cat|cats/; # matches "c"
- "cats" =~ /cats|cat|ca|c/; # matches "cats"
Here, all the alternatives match at the first string position, so thefirst alternative is the one that matches. If some of thealternatives are truncations of the others, put the longest ones firstto give them a chance to match. - "cab" =~ /a|b|c/ # matches "c"
- # /a|b|c/ == /[abc]/
The last example points out that character classes are likealternations of characters. At a given character position, the firstalternative that allows the regexp match to succeed will be the onethat matches. Grouping things and hierarchical matchingAlternation allows a regexp to choose among alternatives, but byitself it is unsatisfying. The reason is that each alternative is a wholeregexp, but sometime we want alternatives for just part of aregexp. For instance, suppose we want to search for housecats orhousekeepers. The regexp housecat|housekeeper fits the bill, but isinefficient because we had to type house twice. It would be nice tohave parts of the regexp be constant, like house , and someparts have alternatives, like cat|keeper . The grouping metacharacters () solve this problem. Groupingallows parts of a regexp to be treated as a single unit. Parts of aregexp are grouped by enclosing them in parentheses. Thus we could solvethe housecat|housekeeper by forming the regexp ashouse(cat|keeper) . The regexp house(cat|keeper) means matchhouse followed by either cat or keeper . Some more examplesare - /(a|b)b/; # matches 'ab' or 'bb'
- /(ac|b)b/; # matches 'acb' or 'bb'
- /(^a|b)c/; # matches 'ac' at start of string or 'bc' anywhere
- /(a|[bc])d/; # matches 'ad', 'bd', or 'cd'
- /house(cat|)/; # matches either 'housecat' or 'house'
- /house(cat(s|)|)/; # matches either 'housecats' or 'housecat' or
- # 'house'. Note groups can be nested.
- /(19|20|)\d\d/; # match years 19xx, 20xx, or the Y2K problem, xx
- "20" =~ /(19|20|)\d\d/; # matches the null alternative '()\d\d',
- # because '20\d\d' can't match
Alternations behave the same way in groups as out of them: at a givenstring position, the leftmost alternative that allows the regexp tomatch is taken. So in the last example at the first string position,"20" matches the second alternative, but there is nothing left overto match the next two digits \d\d . So Perl moves on to the nextalternative, which is the null alternative and that works, since"20" is two digits. The process of trying one alternative, seeing if it matches, andmoving on to the next alternative, while going back in the stringfrom where the previous alternative was tried, if it doesn't, is calledbacktracking. The term 'backtracking' comes from the idea thatmatching a regexp is like a walk in the woods. Successfully matchinga regexp is like arriving at a destination. There are many possibletrailheads, one for each string position, and each one is tried inorder, left to right. From each trailhead there may be many paths,some of which get you there, and some which are dead ends. When youwalk along a trail and hit a dead end, you have to backtrack along thetrail to an earlier point to try another trail. If you hit yourdestination, you stop immediately and forget about trying all theother trails. You are persistent, and only if you have tried all thetrails from all the trailheads and not arrived at your destination, doyou declare failure. To be concrete, here is a step-by-step analysisof what Perl does when it tries to match the regexp - "abcde" =~ /(abd|abc)(df|d|de)/;
- 0
Start with the first letter in the string 'a'. - 1
Try the first alternative in the first group 'abd'. - 2
Match 'a' followed by 'b'. So far so good. - 3
'd' in the regexp doesn't match 'c' in the string - a deadend. So backtrack two characters and pick the second alternative inthe first group 'abc'. - 4
Match 'a' followed by 'b' followed by 'c'. We are on a rolland have satisfied the first group. Set $1 to 'abc'. - 5
Move on to the second group and pick the first alternative'df'. - 6
Match the 'd'. - 7
'f' in the regexp doesn't match 'e' in the string, so a deadend. Backtrack one character and pick the second alternative in thesecond group 'd'. - 8
'd' matches. The second grouping is satisfied, so set $2 to'd'. - 9
We are at the end of the regexp, so we are done! We havematched 'abcd' out of the string "abcde".
There are a couple of things to note about this analysis. First, thethird alternative in the second group 'de' also allows a match, but westopped before we got to it - at a given character position, leftmostwins. Second, we were able to get a match at the first characterposition of the string 'a'. If there were no matches at the firstposition, Perl would move to the second character position 'b' andattempt the match all over again. Only when all possible paths at allpossible character positions have been exhausted does Perl giveup and declare $string =~ /(abd|abc)(df|d|de)/; to be false. Even with all this work, regexp matching happens remarkably fast. Tospeed things up, Perl compiles the regexp into a compact sequence ofopcodes that can often fit inside a processor cache. When the code isexecuted, these opcodes can then run at full throttle and search veryquickly. Extracting matchesThe grouping metacharacters () also serve another completelydifferent function: they allow the extraction of the parts of a stringthat matched. This is very useful to find out what matched and fortext processing in general. For each grouping, the part that matchedinside goes into the special variables $1 , $2 , etc. They can beused just as ordinary variables: - # extract hours, minutes, seconds
- if ($time =~ /(\d\d):(\d\d):(\d\d)/) { # match hh:mm:ss format
- $hours = $1;
- $minutes = $2;
- $seconds = $3;
- }
Now, we know that in scalar context,$time =~ /(\d\d):(\d\d):(\d\d)/ returns a true or falsevalue. In list context, however, it returns the list of matched values($1,$2,$3) . So we could write the code more compactly as - # extract hours, minutes, seconds
- ($hours, $minutes, $second) = ($time =~ /(\d\d):(\d\d):(\d\d)/);
If the groupings in a regexp are nested, $1 gets the group with theleftmost opening parenthesis, $2 the next opening parenthesis,etc. Here is a regexp with nested groups: - /(ab(cd|ef)((gi)|j))/;
- 1 2 34
If this regexp matches, $1 contains a string starting with'ab' , $2 is either set to 'cd' or 'ef' , $3 equals either'gi' or 'j' , and $4 is either set to 'gi' , just like $3 ,or it remains undefined. For convenience, Perl sets $+ to the string held by the highest numbered$1 , $2 ,... that got assigned (and, somewhat related, $^N to thevalue of the $1 , $2 ,... most-recently assigned; i.e. the $1 ,$2 ,... associated with the rightmost closing parenthesis used in thematch). BackreferencesClosely associated with the matching variables $1 , $2 , ... arethe backreferences \g1 , \g2 ,... Backreferences are simplymatching variables that can be used inside a regexp. This is areally nice feature; what matches later in a regexp is made to depend onwhat matched earlier in the regexp. Suppose we wanted to lookfor doubled words in a text, like 'the the'. The following regexp findsall 3-letter doubles with a space in between: - /\b(\w\w\w)\s\g1\b/;
The grouping assigns a value to \g1, so that the same 3-letter sequenceis used for both parts. A similar task is to find words consisting of two identical parts: - % simple_grep '^(\w\w\w\w|\w\w\w|\w\w|\w)\g1$' /usr/dict/words
- beriberi
- booboo
- coco
- mama
- murmur
- papa
The regexp has a single grouping which considers 4-lettercombinations, then 3-letter combinations, etc., and uses \g1 to look fora repeat. Although $1 and \g1 represent the same thing, care should betaken to use matched variables $1 , $2 ,... only outside a regexpand backreferences \g1 , \g2 ,... only inside a regexp; not doingso may lead to surprising and unsatisfactory results. Relative backreferencesCounting the opening parentheses to get the correct number for abackreference is error-prone as soon as there is more than onecapturing group. A more convenient technique became availablewith Perl 5.10: relative backreferences. To refer to the immediatelypreceding capture group one now may write \g{-1} , the next butlast is available via \g{-2} , and so on. Another good reason in addition to readability and maintainabilityfor using relative backreferences is illustrated by the following example,where a simple pattern for matching peculiar strings is used: - $a99a = '([a-z])(\d)\g2\g1'; # matches a11a, g22g, x33x, etc.
Now that we have this pattern stored as a handy string, we might feeltempted to use it as a part of some other pattern: - $line = "code=e99e";
- if ($line =~ /^(\w+)=$a99a$/){ # unexpected behavior!
- print "$1 is valid\n";
- } else {
- print "bad line: '$line'\n";
- }
But this doesn't match, at least not the way one might expect. Onlyafter inserting the interpolated $a99a and looking at the resultingfull text of the regexp is it obvious that the backreferences havebackfired. The subexpression (\w+) has snatched number 1 anddemoted the groups in $a99a by one rank. This can be avoided byusing relative backreferences: - $a99a = '([a-z])(\d)\g{-1}\g{-2}'; # safe for being interpolated
Named backreferencesPerl 5.10 also introduced named capture groups and named backreferences.To attach a name to a capturing group, you write either(?<name>...) or (?'name'...) . The backreference maythen be written as \g{name} . It is permissible to attach thesame name to more than one group, but then only the leftmost one of theeponymous set can be referenced. Outside of the pattern a namedcapture group is accessible through the %+ hash. Assuming that we have to match calendar dates which may be given in oneof the three formats yyyy-mm-dd, mm/dd/yyyy or dd.mm.yyyy, we can writethree suitable patterns where we use 'd', 'm' and 'y' respectively as thenames of the groups capturing the pertaining components of a date. Thematching operation combines the three patterns as alternatives: - $fmt1 = '(?<y>\d\d\d\d)-(?<m>\d\d)-(?<d>\d\d)';
- $fmt2 = '(?<m>\d\d)/(?<d>\d\d)/(?<y>\d\d\d\d)';
- $fmt3 = '(?<d>\d\d)\.(?<m>\d\d)\.(?<y>\d\d\d\d)';
- for my $d qw( 2006-10-21 15.01.2007 10/31/2005 ){
- if ( $d =~ m{$fmt1|$fmt2|$fmt3} ){
- print "day=$+{d} month=$+{m} year=$+{y}\n";
- }
- }
If any of the alternatives matches, the hash %+ is bound to contain thethree key-value pairs. Alternative capture group numberingYet another capturing group numbering technique (also as from Perl 5.10)deals with the problem of referring to groups within a set of alternatives.Consider a pattern for matching a time of the day, civil or military style: - if ( $time =~ /(\d\d|\d):(\d\d)|(\d\d)(\d\d)/ ){
- # process hour and minute
- }
Processing the results requires an additional if statement to determinewhether $1 and $2 or $3 and $4 contain the goodies. It wouldbe easier if we could use group numbers 1 and 2 in second alternative aswell, and this is exactly what the parenthesized construct (?|...) ,set around an alternative achieves. Here is an extended version of theprevious pattern: - if ( $time =~ /(?|(\d\d|\d):(\d\d)|(\d\d)(\d\d))\s+([A-Z][A-Z][A-Z])/ ){
- print "hour=$1 minute=$2 zone=$3\n";
- }
Within the alternative numbering group, group numbers start at the sameposition for each alternative. After the group, numbering continueswith one higher than the maximum reached across all the alternatives. Position informationIn addition to what was matched, Perl (since 5.6.0) also provides thepositions of what was matched as contents of the @- and @+ arrays. $-[0] is the position of the start of the entire match and$+[0] is the position of the end. Similarly, $-[n] is theposition of the start of the $n match and $+[n] is the positionof the end. If $n is undefined, so are $-[n] and $+[n] . Thenthis code - $x = "Mmm...donut, thought Homer";
- $x =~ /^(Mmm|Yech)\.\.\.(donut|peas)/; # matches
- foreach $expr (1..$#-) {
- print "Match $expr: '${$expr}' at position ($-[$expr],$+[$expr])\n";
- }
prints - Match 1: 'Mmm' at position (0,3)
- Match 2: 'donut' at position (6,11)
Even if there are no groupings in a regexp, it is still possible tofind out what exactly matched in a string. If you use them, Perlwill set $` to the part of the string before the match, will set $& to the part of the string that matched, and will set $' to the partof the string after the match. An example: - $x = "the cat caught the mouse";
- $x =~ /cat/; # $` = 'the ', $& = 'cat', $' = ' caught the mouse'
- $x =~ /the/; # $` = '', $& = 'the', $' = ' cat caught the mouse'
In the second match, $` equals '' because the regexp matched at thefirst character position in the string and stopped; it never saw thesecond 'the'. It is important to note that using $` and $' slows down regexp matching quite a bit, while $& slows it down to alesser extent, because if they are used in one regexp in a program,they are generated for all regexps in the program. So if rawperformance is a goal of your application, they should be avoided.If you need to extract the corresponding substrings, use @- and@+ instead: - $` is the same as substr( $x, 0, $-[0] )
- $& is the same as substr( $x, $-[0], $+[0]-$-[0] )
- $' is the same as substr( $x, $+[0] )
As of Perl 5.10, the ${^PREMATCH} , ${^MATCH} and ${^POSTMATCH} variables may be used. These are only set if the /p modifier is present.Consequently they do not penalize the rest of the program. Non-capturing groupingsA group that is required to bundle a set of alternatives may or may not beuseful as a capturing group. If it isn't, it just creates a superfluousaddition to the set of available capture group values, inside as well asoutside the regexp. Non-capturing groupings, denoted by (?:regexp) ,still allow the regexp to be treated as a single unit, but don't establisha capturing group at the same time. Both capturing and non-capturinggroupings are allowed to co-exist in the same regexp. Because there isno extraction, non-capturing groupings are faster than capturinggroupings. Non-capturing groupings are also handy for choosing exactlywhich parts of a regexp are to be extracted to matching variables: - # match a number, $1-$4 are set, but we only want $1
- /([+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?)/;
- # match a number faster , only $1 is set
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE][+-]?\d+)?)/;
- # match a number, get $1 = whole number, $2 = exponent
- /([+-]?\ *(?:\d+(?:\.\d*)?|\.\d+)(?:[eE]([+-]?\d+))?)/;
Non-capturing groupings are also useful for removing nuisanceelements gathered from a split operation where parentheses arerequired for some reason: - $x = '12aba34ba5';
- @num = split /(a|b)+/, $x; # @num = ('12','a','34','a','5')
- @num = split /(?:a|b)+/, $x; # @num = ('12','34','5')
Matching repetitionsThe examples in the previous section display an annoying weakness. Wewere only matching 3-letter words, or chunks of words of 4 letters orless. We'd like to be able to match words or, more generally, stringsof any length, without writing out tedious alternatives like\w\w\w\w|\w\w\w|\w\w|\w . This is exactly the problem the quantifier metacharacters ? ,* , + , and {} were created for. They allow us to delimit thenumber of repeats for a portion of a regexp we consider to be amatch. Quantifiers are put immediately after the character, characterclass, or grouping that we want to specify. They have the followingmeanings: a? means: match 'a' 1 or 0 times
a* means: match 'a' 0 or more times, i.e., any number of times
a+ means: match 'a' 1 or more times, i.e., at least once
a{n,m} means: match at least n times, but not more than m times.
a{n,} means: match at least n or more times
a{n} means: match exactly n times
Here are some examples: - /[a-z]+\s+\d*/; # match a lowercase word, at least one space, and
- # any number of digits
- /(\w+)\s+\g1/; # match doubled words of arbitrary length
- /y(es)?/i; # matches 'y', 'Y', or a case-insensitive 'yes'
- $year =~ /^\d{2,4}$/; # make sure year is at least 2 but not more
- # than 4 digits
- $year =~ /^\d{4}$|^\d{2}$/; # better match; throw out 3-digit dates
- $year =~ /^\d{2}(\d{2})?$/; # same thing written differently. However,
- # this captures the last two digits in $1
- # and the other does not.
- % simple_grep '^(\w+)\g1$' /usr/dict/words # isn't this easier?
- beriberi
- booboo
- coco
- mama
- murmur
- papa
For all of these quantifiers, Perl will try to match as much of thestring as possible, while still allowing the regexp to succeed. Thuswith /a?.../ , Perl will first try to match the regexp with the a present; if that fails, Perl will try to match the regexp without thea present. For the quantifier * , we get the following: - $x = "the cat in the hat";
- $x =~ /^(.*)(cat)(.*)$/; # matches,
- # $1 = 'the '
- # $2 = 'cat'
- # $3 = ' in the hat'
Which is what we might expect, the match finds the only cat in thestring and locks onto it. Consider, however, this regexp: - $x =~ /^(.*)(at)(.*)$/; # matches,
- # $1 = 'the cat in the h'
- # $2 = 'at'
- # $3 = '' (0 characters match)
One might initially guess that Perl would find the at in cat andstop there, but that wouldn't give the longest possible string to thefirst quantifier .* . Instead, the first quantifier .* grabs asmuch of the string as possible while still having the regexp match. Inthis example, that means having the at sequence with the final at in the string. The other important principle illustrated here is that,when there are two or more elements in a regexp, the leftmostquantifier, if there is one, gets to grab as much of the string aspossible, leaving the rest of the regexp to fight over scraps. Thus inour example, the first quantifier .* grabs most of the string, whilethe second quantifier .* gets the empty string. Quantifiers thatgrab as much of the string as possible are called maximal match orgreedy quantifiers. When a regexp can match a string in several different ways, we can usethe principles above to predict which way the regexp will match: Principle 0: Taken as a whole, any regexp will be matched at theearliest possible position in the string. Principle 1: In an alternation a|b|c... , the leftmost alternativethat allows a match for the whole regexp will be the one used. Principle 2: The maximal matching quantifiers ? , * , + and{n,m} will in general match as much of the string as possible whilestill allowing the whole regexp to match. Principle 3: If there are two or more elements in a regexp, theleftmost greedy quantifier, if any, will match as much of the stringas possible while still allowing the whole regexp to match. The nextleftmost greedy quantifier, if any, will try to match as much of thestring remaining available to it as possible, while still allowing thewhole regexp to match. And so on, until all the regexp elements aresatisfied.
As we have seen above, Principle 0 overrides the others. The regexpwill be matched as early as possible, with the other principlesdetermining how the regexp matches at that earliest characterposition. Here is an example of these principles in action: - $x = "The programming republic of Perl";
- $x =~ /^(.+)(e|r)(.*)$/; # matches,
- # $1 = 'The programming republic of Pe'
- # $2 = 'r'
- # $3 = 'l'
This regexp matches at the earliest string position, 'T' . Onemight think that e , being leftmost in the alternation, would bematched, but r produces the longest string in the first quantifier. - $x =~ /(m{1,2})(.*)$/; # matches,
- # $1 = 'mm'
- # $2 = 'ing republic of Perl'
Here, The earliest possible match is at the first 'm' inprogramming . m{1,2} is the first quantifier, so it gets to matcha maximal mm . - $x =~ /.*(m{1,2})(.*)$/; # matches,
- # $1 = 'm'
- # $2 = 'ing republic of Perl'
Here, the regexp matches at the start of the string. The firstquantifier .* grabs as much as possible, leaving just a single'm' for the second quantifier m{1,2} . - $x =~ /(.?)(m{1,2})(.*)$/; # matches,
- # $1 = 'a'
- # $2 = 'mm'
- # $3 = 'ing republic of Perl'
Here, .? eats its maximal one character at the earliest possibleposition in the string, 'a' in programming , leaving m{1,2} the opportunity to match both m 's. Finally, - "aXXXb" =~ /(X*)/; # matches with $1 = ''
because it can match zero copies of 'X' at the beginning of thestring. If you definitely want to match at least one 'X' , useX+ , not X* . Sometimes greed is not good. At times, we would like quantifiers tomatch a minimal piece of string, rather than a maximal piece. Forthis purpose, Larry Wall created the minimal match ornon-greedy quantifiers ?? , *? , +? , and {}? . These arethe usual quantifiers with a ? appended to them. They have thefollowing meanings: a?? means: match 'a' 0 or 1 times. Try 0 first, then 1.
a*? means: match 'a' 0 or more times, i.e., any number of times,but as few times as possible
a+? means: match 'a' 1 or more times, i.e., at least once, butas few times as possible
a{n,m}? means: match at least n times, not more than m times, as few times as possible
a{n,}? means: match at least n times, but as few times aspossible
a{n}? means: match exactly n times. Because we match exactlyn times, a{n}? is equivalent to a{n} and is just there fornotational consistency.
Let's look at the example above, but with minimal quantifiers: - $x = "The programming republic of Perl";
- $x =~ /^(.+?)(e|r)(.*)$/; # matches,
- # $1 = 'Th'
- # $2 = 'e'
- # $3 = ' programming republic of Perl'
The minimal string that will allow both the start of the string ^ and the alternation to match is Th , with the alternation e|r matching e . The second quantifier .* is free to gobble up therest of the string. - $x =~ /(m{1,2}?)(.*?)$/; # matches,
- # $1 = 'm'
- # $2 = 'ming republic of Perl'
The first string position that this regexp can match is at the first'm' in programming . At this position, the minimal m{1,2}? matches just one 'm' . Although the second quantifier .*? wouldprefer to match no characters, it is constrained by the end-of-stringanchor $ to match the rest of the string. - $x =~ /(.*?)(m{1,2}?)(.*)$/; # matches,
- # $1 = 'The progra'
- # $2 = 'm'
- # $3 = 'ming republic of Perl'
In this regexp, you might expect the first minimal quantifier .*? to match the empty string, because it is not constrained by a ^ anchor to match the beginning of the word. Principle 0 applies here,however. Because it is possible for the whole regexp to match at thestart of the string, it will match at the start of the string. Thusthe first quantifier has to match everything up to the first m . Thesecond minimal quantifier matches just one m and the thirdquantifier matches the rest of the string. - $x =~ /(.??)(m{1,2})(.*)$/; # matches,
- # $1 = 'a'
- # $2 = 'mm'
- # $3 = 'ing republic of Perl'
Just as in the previous regexp, the first quantifier .?? can matchearliest at position 'a' , so it does. The second quantifier isgreedy, so it matches mm , and the third matches the rest of thestring. We can modify principle 3 above to take into account non-greedyquantifiers: Principle 3: If there are two or more elements in a regexp, theleftmost greedy (non-greedy) quantifier, if any, will match as much(little) of the string as possible while still allowing the wholeregexp to match. The next leftmost greedy (non-greedy) quantifier, ifany, will try to match as much (little) of the string remainingavailable to it as possible, while still allowing the whole regexp tomatch. And so on, until all the regexp elements are satisfied.
Just like alternation, quantifiers are also susceptible tobacktracking. Here is a step-by-step analysis of the example - $x = "the cat in the hat";
- $x =~ /^(.*)(at)(.*)$/; # matches,
- # $1 = 'the cat in the h'
- # $2 = 'at'
- # $3 = '' (0 matches)
- 0
Start with the first letter in the string 't'. - 1
The first quantifier '.*' starts out by matching the wholestring 'the cat in the hat'. - 2
'a' in the regexp element 'at' doesn't match the end of thestring. Backtrack one character. - 3
'a' in the regexp element 'at' still doesn't match the lastletter of the string 't', so backtrack one more character. - 4
Now we can match the 'a' and the 't'. - 5
Move on to the third element '.*'. Since we are at the end ofthe string and '.*' can match 0 times, assign it the empty string. - 6
We are done!
Most of the time, all this moving forward and backtracking happensquickly and searching is fast. There are some pathological regexps,however, whose execution time exponentially grows with the size of thestring. A typical structure that blows up in your face is of the form - /(a|b+)*/;
The problem is the nested indeterminate quantifiers. There are manydifferent ways of partitioning a string of length n between the + and * : one repetition with b+ of length n, two repetitions withthe first b+ length k and the second with length n-k, m repetitionswhose bits add up to length n, etc. In fact there are an exponentialnumber of ways to partition a string as a function of its length. Aregexp may get lucky and match early in the process, but if there isno match, Perl will try every possibility before giving up. So becareful with nested * 's, {n,m} 's, and + 's. The bookMastering Regular Expressions by Jeffrey Friedl gives a wonderfuldiscussion of this and other efficiency issues. Possessive quantifiersBacktracking during the relentless search for a match may be a wasteof time, particularly when the match is bound to fail. Considerthe simple pattern - /^\w+\s+\w+$/; # a word, spaces, a word
Whenever this is applied to a string which doesn't quite meet thepattern's expectations such as "abc " or "abc def " ,the regex engine will backtrack, approximately once for each characterin the string. But we know that there is no way around taking allof the initial word characters to match the first repetition, that allspaces must be eaten by the middle part, and the same goes for the secondword. With the introduction of the possessive quantifiers in Perl 5.10, wehave a way of instructing the regex engine not to backtrack, with theusual quantifiers with a + appended to them. This makes them greedy aswell as stingy; once they succeed they won't give anything back to permitanother solution. They have the following meanings: a{n,m}+ means: match at least n times, not more than m times,as many times as possible, and don't give anything up. a?+ is shortfor a{0,1}+
a{n,}+ means: match at least n times, but as many times as possible,and don't give anything up. a*+ is short for a{0,}+ and a++ isshort for a{1,}+ .
a{n}+ means: match exactly n times. It is just there fornotational consistency.
These possessive quantifiers represent a special case of a more generalconcept, the independent subexpression, see below. As an example where a possessive quantifier is suitable we considermatching a quoted string, as it appears in several programming languages.The backslash is used as an escape character that indicates that thenext character is to be taken literally, as another character for thestring. Therefore, after the opening quote, we expect a (possiblyempty) sequence of alternatives: either some character except anunescaped quote or backslash or an escaped character. - /"(?:[^"\]++|\.)*+"/;
Building a regexpAt this point, we have all the basic regexp concepts covered, so let'sgive a more involved example of a regular expression. We will build aregexp that matches numbers. The first task in building a regexp is to decide what we want to matchand what we want to exclude. In our case, we want to match bothintegers and floating point numbers and we want to reject any stringthat isn't a number. The next task is to break the problem down into smaller problems thatare easily converted into a regexp. The simplest case is integers. These consist of a sequence of digits,with an optional sign in front. The digits we can represent with\d+ and the sign can be matched with [+-] . Thus the integerregexp is - /[+-]?\d+/; # matches integers
A floating point number potentially has a sign, an integral part, adecimal point, a fractional part, and an exponent. One or more of theseparts is optional, so we need to check out the differentpossibilities. Floating point numbers which are in proper form include123., 0.345, .34, -1e6, and 25.4E-72. As with integers, the sign outfront is completely optional and can be matched by [+-]? . We cansee that if there is no exponent, floating point numbers must have adecimal point, otherwise they are integers. We might be tempted tomodel these with \d*\.\d* , but this would also match just a singledecimal point, which is not a number. So the three cases of floatingpoint number without exponent are - /[+-]?\d+\./; # 1., 321., etc.
- /[+-]?\.\d+/; # .1, .234, etc.
- /[+-]?\d+\.\d+/; # 1.0, 30.56, etc.
These can be combined into a single regexp with a three-way alternation: - /[+-]?(\d+\.\d+|\d+\.|\.\d+)/; # floating point, no exponent
In this alternation, it is important to put '\d+\.\d+' before'\d+\.' . If '\d+\.' were first, the regexp would happily match thatand ignore the fractional part of the number. Now consider floating point numbers with exponents. The keyobservation here is that both integers and numbers with decimalpoints are allowed in front of an exponent. Then exponents, like theoverall sign, are independent of whether we are matching numbers withor without decimal points, and can be 'decoupled' from themantissa. The overall form of the regexp now becomes clear: - /^(optional sign)(integer | f.p. mantissa)(optional exponent)$/;
The exponent is an e or E , followed by an integer. So theexponent regexp is - /[eE][+-]?\d+/; # exponent
Putting all the parts together, we get a regexp that matches numbers: - /^[+-]?(\d+\.\d+|\d+\.|\.\d+|\d+)([eE][+-]?\d+)?$/; # Ta da!
Long regexps like this may impress your friends, but can be hard todecipher. In complex situations like this, the //x modifier for amatch is invaluable. It allows one to put nearly arbitrary whitespaceand comments into a regexp without affecting their meaning. Using it,we can rewrite our 'extended' regexp in the more pleasing form - /^
- [+-]? # first, match an optional sign
- ( # then match integers or f.p. mantissas:
- \d+\.\d+ # mantissa of the form a.b
- |\d+\. # mantissa of the form a.
- |\.\d+ # mantissa of the form .b
- |\d+ # integer of the form a
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
If whitespace is mostly irrelevant, how does one include spacecharacters in an extended regexp? The answer is to backslash it'\ ' or put it in a character class [ ] . The same thinggoes for pound signs: use \# or [#] . For instance, Perl allowsa space between the sign and the mantissa or integer, and we could addthis to our regexp as follows: - /^
- [+-]?\ * # first, match an optional sign *and space*
- ( # then match integers or f.p. mantissas:
- \d+\.\d+ # mantissa of the form a.b
- |\d+\. # mantissa of the form a.
- |\.\d+ # mantissa of the form .b
- |\d+ # integer of the form a
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
In this form, it is easier to see a way to simplify thealternation. Alternatives 1, 2, and 4 all start with \d+ , so itcould be factored out: - /^
- [+-]?\ * # first, match an optional sign
- ( # then match integers or f.p. mantissas:
- \d+ # start out with a ...
- (
- \.\d* # mantissa of the form a.b or a.
- )? # ? takes care of integers of the form a
- |\.\d+ # mantissa of the form .b
- )
- ([eE][+-]?\d+)? # finally, optionally match an exponent
- $/x;
or written in the compact form, - /^[+-]?\ *(\d+(\.\d*)?|\.\d+)([eE][+-]?\d+)?$/;
This is our final regexp. To recap, we built a regexp by specifying the task in detail, breaking down the problem into smaller parts, translating the small parts into regexps, combining the regexps, and optimizing the final combined regexp.
These are also the typical steps involved in writing a computerprogram. This makes perfect sense, because regular expressions areessentially programs written in a little computer language that specifiespatterns. Using regular expressions in PerlThe last topic of Part 1 briefly covers how regexps are used in Perlprograms. Where do they fit into Perl syntax? We have already introduced the matching operator in its default/regexp/ and arbitrary delimiter m!regexp! forms. We have usedthe binding operator =~ and its negation !~ to test for stringmatches. Associated with the matching operator, we have discussed thesingle line //s , multi-line //m , case-insensitive //i andextended //x modifiers. There are a few more things you mightwant to know about matching operators. Prohibiting substitutionIf you change $pattern after the first substitution happens, Perlwill ignore it. If you don't want any substitutions at all, use thespecial delimiter m'' : - @pattern = ('Seuss');
- while (<>) {
- print if m'@pattern'; # matches literal '@pattern', not 'Seuss'
- }
Similar to strings, m'' acts like apostrophes on a regexp; all otherm delimiters act like quotes. If the regexp evaluates to the empty string,the regexp in the last successful match is used instead. So we have - "dog" =~ /d/; # 'd' matches
- "dogbert =~ //; # this matches the 'd' regexp used before
Global matchingThe final two modifiers we will discuss here,//g and //c , concern multiple matches.The modifier //g stands for global matching and allows thematching operator to match within a string as many times as possible.In scalar context, successive invocations against a string will have//g jump from match to match, keeping track of position in thestring as it goes along. You can get or set the position with thepos() function. The use of //g is shown in the following example. Suppose we havea string that consists of words separated by spaces. If we know howmany words there are in advance, we could extract the words usinggroupings: - $x = "cat dog house"; # 3 words
- $x =~ /^\s*(\w+)\s+(\w+)\s+(\w+)\s*$/; # matches,
- # $1 = 'cat'
- # $2 = 'dog'
- # $3 = 'house'
But what if we had an indeterminate number of words? This is the sortof task //g was made for. To extract all words, form the simpleregexp (\w+) and loop over all matches with /(\w+)/g : - while ($x =~ /(\w+)/g) {
- print "Word is $1, ends at position ", pos $x, "\n";
- }
prints - Word is cat, ends at position 3
- Word is dog, ends at position 7
- Word is house, ends at position 13
A failed match or changing the target string resets the position. Ifyou don't want the position reset after failure to match, add the//c , as in /regexp/gc . The current position in the string isassociated with the string, not the regexp. This means that differentstrings have different positions and their respective positions can beset or read independently. In list context, //g returns a list of matched groupings, or ifthere are no groupings, a list of matches to the whole regexp. So ifwe wanted just the words, we could use - @words = ($x =~ /(\w+)/g); # matches,
- # $words[0] = 'cat'
- # $words[1] = 'dog'
- # $words[2] = 'house'
Closely associated with the //g modifier is the \G anchor. The\G anchor matches at the point where the previous //g match leftoff. \G allows us to easily do context-sensitive matching: - $metric = 1; # use metric units
- ...
- $x = <FILE>; # read in measurement
- $x =~ /^([+-]?\d+)\s*/g; # get magnitude
- $weight = $1;
- if ($metric) { # error checking
- print "Units error!" unless $x =~ /\Gkg\./g;
- }
- else {
- print "Units error!" unless $x =~ /\Glbs\./g;
- }
- $x =~ /\G\s+(widget|sprocket)/g; # continue processing
The combination of //g and \G allows us to process the string abit at a time and use arbitrary Perl logic to decide what to do next.Currently, the \G anchor is only fully supported when used to anchorto the start of the pattern. \G is also invaluable in processing fixed-length records withregexps. Suppose we have a snippet of coding region DNA, encoded asbase pair letters ATCGTTGAAT... and we want to find all the stopcodons TGA . In a coding region, codons are 3-letter sequences, sowe can think of the DNA snippet as a sequence of 3-letter records. Thenaive regexp
- # expanded, this is "ATC GTT GAA TGC AAA TGA CAT GAC"
- $dna = "ATCGTTGAATGCAAATGACATGAC";
- $dna =~ /TGA/;
doesn't work; it may match a TGA , but there is no guarantee thatthe match is aligned with codon boundaries, e.g., the substringGTT GAA gives a match. A better solution is - while ($dna =~ /(\w\w\w)*?TGA/g) { # note the minimal *?
- print "Got a TGA stop codon at position ", pos $dna, "\n";
- }
which prints - Got a TGA stop codon at position 18
- Got a TGA stop codon at position 23
Position 18 is good, but position 23 is bogus. What happened? The answer is that our regexp works well until we get past the lastreal match. Then the regexp will fail to match a synchronized TGA and start stepping ahead one character position at a time, not what wewant. The solution is to use \G to anchor the match to the codonalignment: - while ($dna =~ /\G(\w\w\w)*?TGA/g) {
- print "Got a TGA stop codon at position ", pos $dna, "\n";
- }
This prints - Got a TGA stop codon at position 18
which is the correct answer. This example illustrates that it isimportant not only to match what is desired, but to reject what is notdesired. (There are other regexp modifiers that are available, such as//o , but their specialized uses are beyond thescope of this introduction. ) Search and replaceRegular expressions also play a big role in search and replaceoperations in Perl. Search and replace is accomplished with thes/// operator. The general form iss/regexp/replacement/modifiers , with everything we know aboutregexps and modifiers applying in this case as well. Thereplacement is a Perl double-quoted string that replaces in thestring whatever is matched with the regexp . The operator =~ isalso used here to associate a string with s/// . If matchingagainst $_ , the $_ =~ can be dropped. If there is a match,s/// returns the number of substitutions made; otherwise it returnsfalse. Here are a few examples: - $x = "Time to feed the cat!";
- $x =~ s/cat/hacker/; # $x contains "Time to feed the hacker!"
- if ($x =~ s/^(Time.*hacker)!$/$1 now!/) {
- $more_insistent = 1;
- }
- $y = "'quoted words'";
- $y =~ s/^'(.*)'$/$1/; # strip single quotes,
- # $y contains "quoted words"
In the last example, the whole string was matched, but only the partinside the single quotes was grouped. With the s/// operator, thematched variables $1 , $2 , etc. are immediately available for usein the replacement expression, so we use $1 to replace the quotedstring with just what was quoted. With the global modifier, s///g will search and replace all occurrences of the regexp in the string: - $x = "I batted 4 for 4";
- $x =~ s/4/four/; # doesn't do it all:
- # $x contains "I batted four for 4"
- $x = "I batted 4 for 4";
- $x =~ s/4/four/g; # does it all:
- # $x contains "I batted four for four"
If you prefer 'regex' over 'regexp' in this tutorial, you could usethe following program to replace it: - % cat > simple_replace
- #!/usr/bin/perl
- $regexp = shift;
- $replacement = shift;
- while (<>) {
- s/$regexp/$replacement/g;
- print;
- }
- ^D
- % simple_replace regexp regex perlretut.pod
In simple_replace we used the s///g modifier to replace alloccurrences of the regexp on each line. (Even though the regularexpression appears in a loop, Perl is smart enough to compile itonly once.) As with simple_grep , both theprint and the s/$regexp/$replacement/g use $_ implicitly. If you don't want s/// to change your original variable you can usethe non-destructive substitute modifier, s///r . This changes thebehavior so that s///r returns the final substituted string(instead of the number of substitutions): - $x = "I like dogs.";
- $y = $x =~ s/dogs/cats/r;
- print "$x $y\n";
That example will print "I like dogs. I like cats". Notice the original$x variable has not been affected. The overallresult of the substitution is instead stored in $y . If thesubstitution doesn't affect anything then the original string isreturned: - $x = "I like dogs.";
- $y = $x =~ s/elephants/cougars/r;
- print "$x $y\n"; # prints "I like dogs. I like dogs."
One other interesting thing that the s///r flag allows is chainingsubstitutions: - $x = "Cats are great.";
- print $x =~ s/Cats/Dogs/r =~ s/Dogs/Frogs/r =~ s/Frogs/Hedgehogs/r, "\n";
- # prints "Hedgehogs are great."
A modifier available specifically to search and replace is thes///e evaluation modifier. s///e treats thereplacement text as Perl code, rather than a double-quotedstring. The value that the code returns is substituted for thematched substring. s///e is useful if you need to do a bit ofcomputation in the process of replacing text. This example countscharacter frequencies in a line: - $x = "Bill the cat";
- $x =~ s/(.)/$chars{$1}++;$1/eg; # final $1 replaces char with itself
- print "frequency of '$_' is $chars{$_}\n"
- foreach (sort {$chars{$b} <=> $chars{$a}} keys %chars);
This prints - frequency of ' ' is 2
- frequency of 't' is 2
- frequency of 'l' is 2
- frequency of 'B' is 1
- frequency of 'c' is 1
- frequency of 'e' is 1
- frequency of 'h' is 1
- frequency of 'i' is 1
- frequency of 'a' is 1
As with the match m// operator, s/// can use other delimiters,such as s!!! and s{}{} , and even s{}// . If single quotes areused s''' , then the regexp and replacement aretreated as single-quoted strings and there are novariable substitutions. s/// in list contextreturns the same thing as in scalar context, i.e., the number ofmatches. The split functionThe split() function is another place where a regexp is used.split /regexp/, string, limit separates the string operand intoa list of substrings and returns that list. The regexp must be designedto match whatever constitutes the separators for the desired substrings.The limit , if present, constrains splitting into no more than limit number of strings. For example, to split a string into words, use - $x = "Calvin and Hobbes";
- @words = split /\s+/, $x; # $word[0] = 'Calvin'
- # $word[1] = 'and'
- # $word[2] = 'Hobbes'
If the empty regexp // is used, the regexp always matches andthe string is split into individual characters. If the regexp hasgroupings, then the resulting list contains the matched substrings from thegroupings as well. For instance, - $x = "/usr/bin/perl";
- @dirs = split m!/!, $x; # $dirs[0] = ''
- # $dirs[1] = 'usr'
- # $dirs[2] = 'bin'
- # $dirs[3] = 'perl'
- @parts = split m!(/)!, $x; # $parts[0] = ''
- # $parts[1] = '/'
- # $parts[2] = 'usr'
- # $parts[3] = '/'
- # $parts[4] = 'bin'
- # $parts[5] = '/'
- # $parts[6] = 'perl'
Since the first character of $x matched the regexp, split prependedan empty initial element to the list. If you have read this far, congratulations! You now have all the basictools needed to use regular expressions to solve a wide range of textprocessing problems. If this is your first time through the tutorial,why not stop here and play around with regexps a while.... Part 2concerns the more esoteric aspects of regular expressions and thoseconcepts certainly aren't needed right at the start. Part 2: Power toolsOK, you know the basics of regexps and you want to know more. Ifmatching regular expressions is analogous to a walk in the woods, thenthe tools discussed in Part 1 are analogous to topo maps and acompass, basic tools we use all the time. Most of the tools in part 2are analogous to flare guns and satellite phones. They aren't usedtoo often on a hike, but when we are stuck, they can be invaluable. What follows are the more advanced, less used, or sometimes esotericcapabilities of Perl regexps. In Part 2, we will assume you arecomfortable with the basics and concentrate on the advanced features. More on characters, strings, and character classesThere are a number of escape sequences and character classes that wehaven't covered yet. There are several escape sequences that convert characters or stringsbetween upper and lower case, and they are also available withinpatterns. \l and \u convert the next character to lower orupper case, respectively: - $x = "perl";
- $string =~ /\u$x/; # matches 'Perl' in $string
- $x = "M(rs?|s)\."; # note the double backslash
- $string =~ /\l$x/; # matches 'mr.', 'mrs.', and 'ms.',
A \L or \U indicates a lasting conversion of case, untilterminated by \E or thrown over by another \U or \L : - $x = "This word is in lower case:\L SHOUT\E";
- $x =~ /shout/; # matches
- $x = "I STILL KEYPUNCH CARDS FOR MY 360"
- $x =~ /\Ukeypunch/; # matches punch card string
If there is no \E , case is converted until the end of thestring. The regexps \L\u$word or \u\L$word convert the firstcharacter of $word to uppercase and the rest of the characters tolowercase. Control characters can be escaped with \c , so that a control-Zcharacter would be matched with \cZ . The escape sequence\Q ...\E quotes, or protects most non-alphabetic characters. Forinstance, - $x = "\QThat !^*&%~& cat!";
- $x =~ /\Q!^*&%~&\E/; # check for rough language
It does not protect $ or @ , so that variables can still besubstituted. \Q , \L , \l , \U , \u and \E are actually part ofdouble-quotish syntax, and not part of regexp syntax proper. They willwork if they appear in a regular expression embedded directly in aprogram, but not when contained in a string that is interpolated in apattern.
With the advent of 5.6.0, Perl regexps can handle more than just thestandard ASCII character set. Perl now supports Unicode, a standardfor representing the alphabets from virtually all of the world's writtenlanguages, and a host of symbols. Perl's text strings are Unicode strings, sothey can contain characters with a value (codepoint or character number) higherthan 255. What does this mean for regexps? Well, regexp users don't need to knowmuch about Perl's internal representation of strings. But they do needto know 1) how to represent Unicode characters in a regexp and 2) thata matching operation will treat the string to be searched as a sequenceof characters, not bytes. The answer to 1) is that Unicode charactersgreater than chr(255) are represented using the \x{hex} notation, because\x hex (without curly braces) doesn't go further than 255. (Starting in Perl5.14, if you're an octal fan, you can also use \o{oct} .) - /\x{263a}/; # match a Unicode smiley face :)
NOTE: In Perl 5.6.0 it used to be that one needed to say useutf8 to use any Unicode features. This is no more the case: foralmost all Unicode processing, the explicit utf8 pragma is notneeded. (The only case where it matters is if your Perl script is inUnicode and encoded in UTF-8, then an explicit use utf8 is needed.) Figuring out the hexadecimal sequence of a Unicode character you wantor deciphering someone else's hexadecimal Unicode regexp is about asmuch fun as programming in machine code. So another way to specifyUnicode characters is to use the named character escapesequence \N{name} . name is a name for the Unicode character, asspecified in the Unicode standard. For instance, if we wanted torepresent or match the astrological sign for the planet Mercury, wecould use - $x = "abc\N{MERCURY}def";
- $x =~ /\N{MERCURY}/; # matches
One can also use "short" names: - print "\N{GREEK SMALL LETTER SIGMA} is called sigma.\n";
- print "\N{greek:Sigma} is an upper-case sigma.\n";
You can also restrict names to a certain alphabet by specifying thecharnames pragma: - use charnames qw(greek);
- print "\N{sigma} is Greek sigma\n";
An index of character names is available on-line from the UnicodeConsortium, http://www.unicode.org/charts/charindex.html; explanatorymaterial with links to other resources athttp://www.unicode.org/standard/where. The answer to requirement 2) is, as of 5.6.0, that a regexp (mostly)uses Unicode characters. (The "mostly" is for messy backwardcompatibility reasons, but starting in Perl 5.14, any regex compiled inthe scope of a use feature 'unicode_strings' (which is automaticallyturned on within the scope of a use 5.012 or higher) will turn that"mostly" into "always". If you want to handle Unicode properly, youshould ensure that 'unicode_strings' is turned on.)Internally, this is encoded to bytes using either UTF-8 or a native 8bit encoding, depending on the history of the string, but conceptuallyit is a sequence of characters, not bytes. See perlunitut for atutorial about that. Let us now discuss Unicode character classes. Just as with Unicodecharacters, there are named Unicode character classes represented by the\p{name} escape sequence. Closely associated is the \P{name} character class, which is the negation of the \p{name} class. Forexample, to match lower and uppercase characters, - $x = "BOB";
- $x =~ /^\p{IsUpper}/; # matches, uppercase char class
- $x =~ /^\P{IsUpper}/; # doesn't match, char class sans uppercase
- $x =~ /^\p{IsLower}/; # doesn't match, lowercase char class
- $x =~ /^\P{IsLower}/; # matches, char class sans lowercase
(The "Is" is optional.) Here is the association between some Perl named classes and thetraditional Unicode classes: - Perl class name Unicode class name or regular expression
- IsAlpha /^[LM]/
- IsAlnum /^[LMN]/
- IsASCII $code <= 127
- IsCntrl /^C/
- IsBlank $code =~ /^(0020|0009)$/ || /^Z[^lp]/
- IsDigit Nd
- IsGraph /^([LMNPS]|Co)/
- IsLower Ll
- IsPrint /^([LMNPS]|Co|Zs)/
- IsPunct /^P/
- IsSpace /^Z/ || ($code =~ /^(0009|000A|000B|000C|000D)$/
- IsSpacePerl /^Z/ || ($code =~ /^(0009|000A|000C|000D|0085|2028|2029)$/
- IsUpper /^L[ut]/
- IsWord /^[LMN]/ || $code eq "005F"
- IsXDigit $code =~ /^00(3[0-9]|[46][1-6])$/
You can also use the official Unicode class names with \p and\P , like \p{L} for Unicode 'letters', \p{Lu} for uppercaseletters, or \P{Nd} for non-digits. If a name is just oneletter, the braces can be dropped. For instance, \pM is thecharacter class of Unicode 'marks', for example accent marks.For the full list see perlunicode. Unicode has also been separated into various sets of characterswhich you can test with \p{...} (in) and \P{...} (not in).To test whether a character is (or is not) an element of a scriptyou would use the script name, for example \p{Latin} , \p{Greek} ,or \P{Katakana} . What we have described so far is the single form of the \p{...} characterclasses. There is also a compound form which you may run into. Theselook like \p{name=value} or \p{name:value} (the equals sign and coloncan be used interchangeably). These are more general than the single form,and in fact most of the single forms are just Perl-defined shortcuts for commoncompound forms. For example, the script examples in the previous paragraphcould be written equivalently as \p{Script=Latin} , \p{Script:Greek} , and\P{script=katakana} (case is irrelevant between the {} braces). You maynever have to use the compound forms, but sometimes it is necessary, and theiruse can make your code easier to understand. \X is an abbreviation for a character class that comprisesa Unicode extended grapheme cluster. This represents a "logical character":what appears to be a single character, but may be represented internally by morethan one. As an example, using the Unicode full names, e.g., A + COMBININGRING is a grapheme cluster with base character A and combining characterCOMBINING RING , which translates in Danish to A with the circle atop it,as in the word Angstrom.
For the full and latest information about Unicode see the latestUnicode standard, or the Unicode Consortium's website http://www.unicode.org As if all those classes weren't enough, Perl also defines POSIX-stylecharacter classes. These have the form [:name:] , with name thename of the POSIX class. The POSIX classes are alpha , alnum ,ascii , cntrl , digit , graph , lower , print , punct ,space , upper , and xdigit , and two extensions, word (a Perlextension to match \w ), and blank (a GNU extension). The //a modifier restricts these to matching just in the ASCII range; otherwisethey can match the same as their corresponding Perl Unicode classes:[:upper:] is the same as \p{IsUpper} , etc. (There are someexceptions and gotchas with this; see perlrecharclass for a fulldiscussion.) The [:digit:] , [:word:] , and[:space:] correspond to the familiar \d , \w , and \s character classes. To negate a POSIX class, put a ^ in front ofthe name, so that, e.g., [:^digit:] corresponds to \D and, underUnicode, \P{IsDigit} . The Unicode and POSIX character classes canbe used just like \d , with the exception that POSIX characterclasses can only be used inside of a character class: - /\s+[abc[:digit:]xyz]\s*/; # match a,b,c,x,y,z, or a digit
- /^=item\s[[:digit:]]/; # match '=item',
- # followed by a space and a digit
- /\s+[abc\p{IsDigit}xyz]\s+/; # match a,b,c,x,y,z, or a digit
- /^=item\s\p{IsDigit}/; # match '=item',
- # followed by a space and a digit
Whew! That is all the rest of the characters and character classes. Compiling and saving regular expressionsIn Part 1 we mentioned that Perl compiles a regexp into a compactsequence of opcodes. Thus, a compiled regexp is a data structurethat can be stored once and used again and again. The regexp quoteqr// does exactly that: qr/string/ compiles the string as aregexp and transforms the result into a form that can be assigned to avariable: - $reg = qr/foo+bar?/; # reg contains a compiled regexp
Then $reg can be used as a regexp: - $x = "fooooba";
- $x =~ $reg; # matches, just like /foo+bar?/
- $x =~ /$reg/; # same thing, alternate form
$reg can also be interpolated into a larger regexp:
- $x =~ /(abc)?$reg/; # still matches
As with the matching operator, the regexp quote can use differentdelimiters, e.g., qr!! , qr{} or qr~~ . Apostrophesas delimiters (qr'' ) inhibit any interpolation. Pre-compiled regexps are useful for creating dynamic matches thatdon't need to be recompiled each time they are encountered. Usingpre-compiled regexps, we write a grep_step program which grepsfor a sequence of patterns, advancing to the next pattern as soonas one has been satisfied. - % cat > grep_step
- #!/usr/bin/perl
- # grep_step - match <number> regexps, one after the other
- # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
- $number = shift;
- $regexp[$_] = shift foreach (0..$number-1);
- @compiled = map qr/$_/, @regexp;
- while ($line = <>) {
- if ($line =~ /$compiled[0]/) {
- print $line;
- shift @compiled;
- last unless @compiled;
- }
- }
- ^D
- % grep_step 3 shift print last grep_step
- $number = shift;
- print $line;
- last unless @compiled;
Storing pre-compiled regexps in an array @compiled allows us tosimply loop through the regexps without any recompilation, thus gainingflexibility without sacrificing speed. Composing regular expressions at runtimeBacktracking is more efficient than repeated tries with different regularexpressions. If there are several regular expressions and a match withany of them is acceptable, then it is possible to combine them into a setof alternatives. If the individual expressions are input data, thiscan be done by programming a join operation. We'll exploit this idea inan improved version of the simple_grep program: a program that matchesmultiple patterns: - % cat > multi_grep
- #!/usr/bin/perl
- # multi_grep - match any of <number> regexps
- # usage: multi_grep <number> regexp1 regexp2 ... file1 file2 ...
- $number = shift;
- $regexp[$_] = shift foreach (0..$number-1);
- $pattern = join '|', @regexp;
- while ($line = <>) {
- print $line if $line =~ /$pattern/;
- }
- ^D
- % multi_grep 2 shift for multi_grep
- $number = shift;
- $regexp[$_] = shift foreach (0..$number-1);
Sometimes it is advantageous to construct a pattern from the inputthat is to be analyzed and use the permissible values on the lefthand side of the matching operations. As an example for this somewhatparadoxical situation, let's assume that our input contains a commandverb which should match one out of a set of available command verbs,with the additional twist that commands may be abbreviated as long asthe given string is unique. The program below demonstrates the basicalgorithm. - % cat > keymatch
- #!/usr/bin/perl
- $kwds = 'copy compare list print';
- while( $command = <> ){
- $command =~ s/^\s+|\s+$//g; # trim leading and trailing spaces
- if( ( @matches = $kwds =~ /\b$command\w*/g ) == 1 ){
- print "command: '@matches'\n";
- } elsif( @matches == 0 ){
- print "no such command: '$command'\n";
- } else {
- print "not unique: '$command' (could be one of: @matches)\n";
- }
- }
- ^D
- % keymatch
- li
- command: 'list'
- co
- not unique: 'co' (could be one of: copy compare)
- printer
- no such command: 'printer'
Rather than trying to match the input against the keywords, we match thecombined set of keywords against the input. The pattern matchingoperation $kwds =~ /\b($command\w*)/g does several things at thesame time. It makes sure that the given command begins where a keywordbegins (\b ). It tolerates abbreviations due to the added \w* . Ittells us the number of matches (scalar @matches ) and all the keywordsthat were actually matched. You could hardly ask for more. Embedding comments and modifiers in a regular expressionStarting with this section, we will be discussing Perl's set ofextended patterns. These are extensions to the traditional regularexpression syntax that provide powerful new tools for patternmatching. We have already seen extensions in the form of the minimalmatching constructs ?? , *? , +? , {n,m}? , and {n,}? . Mostof the extensions below have the form (?char...) , where thechar is a character that determines the type of extension. The first extension is an embedded comment (?#text) . This embeds acomment into the regular expression without affecting its meaning. Thecomment should not have any closing parentheses in the text. Anexample is - /(?# Match an integer:)[+-]?\d+/;
This style of commenting has been largely superseded by the raw,freeform commenting that is allowed with the //x modifier. Most modifiers, such as //i , //m , //s and //x (or anycombination thereof) can also be embedded ina regexp using (?i) , (?m) , (?s) , and (?x) . For instance, - /(?i)yes/; # match 'yes' case insensitively
- /yes/i; # same thing
- /(?x)( # freeform version of an integer regexp
- [+-]? # match an optional sign
- \d+ # match a sequence of digits
- )
- /x;
Embedded modifiers can have two important advantages over the usualmodifiers. Embedded modifiers allow a custom set of modifiers toeach regexp pattern. This is great for matching an array of regexpsthat must have different modifiers: - $pattern[0] = '(?i)doctor';
- $pattern[1] = 'Johnson';
- ...
- while (<>) {
- foreach $patt (@pattern) {
- print if /$patt/;
- }
- }
The second advantage is that embedded modifiers (except //p , whichmodifies the entire regexp) only affect the regexpinside the group the embedded modifier is contained in. So groupingcan be used to localize the modifier's effects: - /Answer: ((?i)yes)/; # matches 'Answer: yes', 'Answer: YES', etc.
Embedded modifiers can also turn off any modifiers already presentby using, e.g., (?-i) . Modifiers can also be combined intoa single expression, e.g., (?s-i) turns on single line mode andturns off case insensitivity. Embedded modifiers may also be added to a non-capturing grouping.(?i-m:regexp) is a non-capturing grouping that matches regexp case insensitively and turns off multi-line mode. Looking ahead and looking behindThis section concerns the lookahead and lookbehind assertions. First,a little background. In Perl regular expressions, most regexp elements 'eat up' a certainamount of string when they match. For instance, the regexp element[abc}] eats up one character of the string when it matches, in thesense that Perl moves to the next character position in the stringafter the match. There are some elements, however, that don't eat upcharacters (advance the character position) if they match. The exampleswe have seen so far are the anchors. The anchor ^ matches thebeginning of the line, but doesn't eat any characters. Similarly, theword boundary anchor \b matches wherever a character matching \w is next to a character that doesn't, but it doesn't eat up anycharacters itself. Anchors are examples of zero-width assertions:zero-width, because they consumeno characters, and assertions, because they test some property of thestring. In the context of our walk in the woods analogy to regexpmatching, most regexp elements move us along a trail, but anchors haveus stop a moment and check our surroundings. If the local environmentchecks out, we can proceed forward. But if the local environmentdoesn't satisfy us, we must backtrack. Checking the environment entails either looking ahead on the trail,looking behind, or both. ^ looks behind, to see that there are nocharacters before. $ looks ahead, to see that there are nocharacters after. \b looks both ahead and behind, to see if thecharacters on either side differ in their "word-ness". The lookahead and lookbehind assertions are generalizations of theanchor concept. Lookahead and lookbehind are zero-width assertionsthat let us specify which characters we want to test for. Thelookahead assertion is denoted by (?=regexp) and the lookbehindassertion is denoted by (?<=fixed-regexp) . Some examples are - $x = "I catch the housecat 'Tom-cat' with catnip";
- $x =~ /cat(?=\s)/; # matches 'cat' in 'housecat'
- @catwords = ($x =~ /(?<=\s)cat\w+/g); # matches,
- # $catwords[0] = 'catch'
- # $catwords[1] = 'catnip'
- $x =~ /\bcat\b/; # matches 'cat' in 'Tom-cat'
- $x =~ /(?<=\s)cat(?=\s)/; # doesn't match; no isolated 'cat' in
- # middle of $x
Note that the parentheses in (?=regexp) and (?<=regexp) arenon-capturing, since these are zero-width assertions. Thus in thesecond regexp, the substrings captured are those of the whole regexpitself. Lookahead (?=regexp) can match arbitrary regexps, butlookbehind (?<=fixed-regexp) only works for regexps of fixedwidth, i.e., a fixed number of characters long. Thus(?<=(ab|bc)) is fine, but (?<=(ab)*) is not. Thenegated versions of the lookahead and lookbehind assertions aredenoted by (?!regexp) and (?<!fixed-regexp) respectively.They evaluate true if the regexps do not match: - $x = "foobar";
- $x =~ /foo(?!bar)/; # doesn't match, 'bar' follows 'foo'
- $x =~ /foo(?!baz)/; # matches, 'baz' doesn't follow 'foo'
- $x =~ /(?<!\s)foo/; # matches, there is no \s before 'foo'
The \C is unsupported in lookbehind, because the alreadytreacherous definition of \C would become even more sowhen going backwards. Here is an example where a string containing blank-separated words,numbers and single dashes is to be split into its components.Using /\s+/ alone won't work, because spaces are not required betweendashes, or a word or a dash. Additional places for a split are establishedby looking ahead and behind: - $str = "one two - --6-8";
- @toks = split / \s+ # a run of spaces
- | (?<=\S) (?=-) # any non-space followed by '-'
- | (?<=-) (?=\S) # a '-' followed by any non-space
- /x, $str; # @toks = qw(one two - - - 6 - 8)
Using independent subexpressions to prevent backtrackingIndependent subexpressions are regular expressions, in thecontext of a larger regular expression, that function independently ofthe larger regular expression. That is, they consume as much or aslittle of the string as they wish without regard for the ability ofthe larger regexp to match. Independent subexpressions are representedby (?>regexp) . We can illustrate their behavior by firstconsidering an ordinary regexp: - $x = "ab";
- $x =~ /a*ab/; # matches
This obviously matches, but in the process of matching, thesubexpression a* first grabbed the a . Doing so, however,wouldn't allow the whole regexp to match, so after backtracking, a* eventually gave back the a and matched the empty string. Here, whata* matched was dependent on what the rest of the regexp matched. Contrast that with an independent subexpression: - $x =~ /(?>a*)ab/; # doesn't match!
The independent subexpression (?>a*) doesn't care about the restof the regexp, so it sees an a and grabs it. Then the rest of theregexp ab cannot match. Because (?>a*) is independent, thereis no backtracking and the independent subexpression does not giveup its a . Thus the match of the regexp as a whole fails. A similarbehavior occurs with completely independent regexps: - $x = "ab";
- $x =~ /a*/g; # matches, eats an 'a'
- $x =~ /\Gab/g; # doesn't match, no 'a' available
Here //g and \G create a 'tag team' handoff of the string fromone regexp to the other. Regexps with an independent subexpression aremuch like this, with a handoff of the string to the independentsubexpression, and a handoff of the string back to the enclosingregexp. The ability of an independent subexpression to prevent backtrackingcan be quite useful. Suppose we want to match a non-empty stringenclosed in parentheses up to two levels deep. Then the followingregexp matches: - $x = "abc(de(fg)h"; # unbalanced parentheses
- $x =~ /\( ( [^()]+ | \([^()]*\) )+ \)/x;
The regexp matches an open parenthesis, one or more copies of analternation, and a close parenthesis. The alternation is two-way, withthe first alternative [^()]+ matching a substring with noparentheses and the second alternative \([^()]*\) matching asubstring delimited by parentheses. The problem with this regexp isthat it is pathological: it has nested indeterminate quantifiersof the form (a+|b)+ . We discussed in Part 1 how nested quantifierslike this could take an exponentially long time to execute if therewas no match possible. To prevent the exponential blowup, we need toprevent useless backtracking at some point. This can be done byenclosing the inner quantifier as an independent subexpression: - $x =~ /\( ( (?>[^()]+) | \([^()]*\) )+ \)/x;
Here, (?>[^()]+) breaks the degeneracy of string partitioningby gobbling up as much of the string as possible and keeping it. Thenmatch failures fail much more quickly. Conditional expressionsA conditional expression is a form of if-then-else statementthat allows one to choose which patterns are to be matched, based onsome condition. There are two types of conditional expression:(?(condition)yes-regexp) and(?(condition)yes-regexp|no-regexp) . (?(condition)yes-regexp) islike an 'if () {}' statement in Perl. If the condition is true,the yes-regexp will be matched. If the condition is false, theyes-regexp will be skipped and Perl will move onto the next regexpelement. The second form is like an 'if () {} else {}' statementin Perl. If the condition is true, the yes-regexp will bematched, otherwise the no-regexp will be matched. The condition can have several forms. The first form is simply aninteger in parentheses (integer) . It is true if the correspondingbackreference \integer matched earlier in the regexp. The samething can be done with a name associated with a capture group, writtenas (<name>) or ('name') . The second form is a barezero-width assertion (?...) , either a lookahead, a lookbehind, or acode assertion (discussed in the next section). The third set of formsprovides tests that return true if the expression is executed withina recursion ((R) ) or is being called from some capturing group,referenced either by number ((R1) , (R2) ,...) or by name((R&name) ). The integer or name form of the condition allows us to choose,with more flexibility, what to match based on what matched earlier in theregexp. This searches for words of the form "$x$x" or "$x$y$y$x" : - % simple_grep '^(\w+)(\w+)?(?(2)\g2\g1|\g1)$' /usr/dict/words
- beriberi
- coco
- couscous
- deed
- ...
- toot
- toto
- tutu
The lookbehind condition allows, along with backreferences,an earlier part of the match to influence a later part of thematch. For instance, - /[ATGC]+(?(?<=AA)G|C)$/;
matches a DNA sequence such that it either ends in AAG , or someother base pair combination and C . Note that the form is(?(?<=AA)G|C) and not (?((?<=AA))G|C) ; for thelookahead, lookbehind or code assertions, the parentheses around theconditional are not needed. Defining named patternsSome regular expressions use identical subpatterns in several places.Starting with Perl 5.10, it is possible to define named subpatterns ina section of the pattern so that they can be called up by nameanywhere in the pattern. This syntactic pattern for this definitiongroup is (?(DEFINE)(?<name>pattern)...) . An insertionof a named pattern is written as (?&name) . The example below illustrates this feature using the pattern forfloating point numbers that was presented earlier on. The threesubpatterns that are used more than once are the optional sign, thedigit sequence for an integer and the decimal fraction. The DEFINEgroup at the end of the pattern contains their definition. Noticethat the decimal fraction pattern is the first place where we canreuse the integer pattern. - /^ (?&osg)\ * ( (?&int)(?&dec)? | (?&dec) )
- (?: [eE](?&osg)(?&int) )?
- $
- (?(DEFINE)
- (?<osg>[-+]?) # optional sign
- (?<int>\d++) # integer
- (?<dec>\.(?&int)) # decimal fraction
- )/x
Recursive patternsThis feature (introduced in Perl 5.10) significantly extends thepower of Perl's pattern matching. By referring to some othercapture group anywhere in the pattern with the construct(?group-ref) , the pattern within the referenced group is usedas an independent subpattern in place of the group reference itself.Because the group reference may be contained within the group itrefers to, it is now possible to apply pattern matching to tasks thathitherto required a recursive parser. To illustrate this feature, we'll design a pattern that matches ifa string contains a palindrome. (This is a word or a sentence that,while ignoring spaces, interpunctuation and case, reads the same backwardsas forwards. We begin by observing that the empty string or a stringcontaining just one word character is a palindrome. Otherwise it musthave a word character up front and the same at its end, with anotherpalindrome in between. - /(?: (\w) (?...Here be a palindrome...) \g{-1} | \w? )/x
Adding \W* at either end to eliminate what is to be ignored, we alreadyhave the full pattern: - my $pp = qr/^(\W* (?: (\w) (?1) \g{-1} | \w? ) \W*)$/ix;
- for $s ( "saippuakauppias", "A man, a plan, a canal: Panama!" ){
- print "'$s' is a palindrome\n" if $s =~ /$pp/;
- }
In (?...) both absolute and relative backreferences may be used.The entire pattern can be reinserted with (?R) or (?0) .If you prefer to name your groups, you can use (?&name) torecurse into that group. A bit of magic: executing Perl code in a regular expressionNormally, regexps are a part of Perl expressions.Code evaluation expressions turn that around by allowingarbitrary Perl code to be a part of a regexp. A code evaluationexpression is denoted (?{code}) , with code a string of Perlstatements. Be warned that this feature is considered experimental, and may bechanged without notice. Code expressions are zero-width assertions, and the value they returndepends on their environment. There are two possibilities: either thecode expression is used as a conditional in a conditional expression(?(condition)...) , or it is not. If the code expression is aconditional, the code is evaluated and the result (i.e., the result ofthe last statement) is used to determine truth or falsehood. If thecode expression is not used as a conditional, the assertion alwaysevaluates true and the result is put into the special variable$^R . The variable $^R can then be used in code expressions laterin the regexp. Here are some silly examples: - $x = "abcdef";
- $x =~ /abc(?{print "Hi Mom!"})def/; # matches,
- # prints 'Hi Mom!'
- $x =~ /aaa(?{print "Hi Mom!"})def/; # doesn't match,
- # no 'Hi Mom!'
Pay careful attention to the next example: - $x =~ /abc(?{print "Hi Mom!"})ddd/; # doesn't match,
- # no 'Hi Mom!'
- # but why not?
At first glance, you'd think that it shouldn't print, because obviouslythe ddd isn't going to match the target string. But look at thisexample: - $x =~ /abc(?{print "Hi Mom!"})[dD]dd/; # doesn't match,
- # but _does_ print
Hmm. What happened here? If you've been following along, you know thatthe above pattern should be effectively (almost) the same as the last one;enclosing the d in a character class isn't going to change what itmatches. So why does the first not print while the second one does? The answer lies in the optimizations the regex engine makes. In the firstcase, all the engine sees are plain old characters (aside from the?{} construct). It's smart enough to realize that the string 'ddd'doesn't occur in our target string before actually running the patternthrough. But in the second case, we've tricked it into thinking that ourpattern is more complicated. It takes a look, sees ourcharacter class, and decides that it will have to actually run thepattern to determine whether or not it matches, and in the process ofrunning it hits the print statement before it discovers that we don'thave a match. To take a closer look at how the engine does optimizations, see thesection Pragmas and debugging below. More fun with ?{} : - $x =~ /(?{print "Hi Mom!"})/; # matches,
- # prints 'Hi Mom!'
- $x =~ /(?{$c = 1;})(?{print "$c"})/; # matches,
- # prints '1'
- $x =~ /(?{$c = 1;})(?{print "$^R"})/; # matches,
- # prints '1'
The bit of magic mentioned in the section title occurs when the regexpbacktracks in the process of searching for a match. If the regexpbacktracks over a code expression and if the variables used within arelocalized using local , the changes in the variables produced by thecode expression are undone! Thus, if we wanted to count how many timesa character got matched inside a group, we could use, e.g., - $x = "aaaa";
- $count = 0; # initialize 'a' count
- $c = "bob"; # test if $c gets clobbered
- $x =~ /(?{local $c = 0;}) # initialize count
- ( a # match 'a'
- (?{local $c = $c + 1;}) # increment count
- )* # do this any number of times,
- aa # but match 'aa' at the end
- (?{$count = $c;}) # copy local $c var into $count
- /x;
- print "'a' count is $count, \$c variable is '$c'\n";
This prints - 'a' count is 2, $c variable is 'bob'
If we replace the (?{local $c = $c + 1;}) with (?{$c = $c + 1;}) , the variable changes are not undoneduring backtracking, and we get - 'a' count is 4, $c variable is 'bob'
Note that only localized variable changes are undone. Other sideeffects of code expression execution are permanent. Thus - $x = "aaaa";
- $x =~ /(a(?{print "Yow\n"}))*aa/;
produces - Yow
- Yow
- Yow
- Yow
The result $^R is automatically localized, so that it will behaveproperly in the presence of backtracking. This example uses a code expression in a conditional to match adefinite article, either 'the' in English or 'der|die|das' in German: - $lang = 'DE'; # use German
- ...
- $text = "das";
- print "matched\n"
- if $text =~ /(?(?{
- $lang eq 'EN'; # is the language English?
- })
- the | # if so, then match 'the'
- (der|die|das) # else, match 'der|die|das'
- )
- /xi;
Note that the syntax here is (?(?{...})yes-regexp|no-regexp) , not(?((?{...}))yes-regexp|no-regexp) . In other words, in the case of acode expression, we don't need the extra parentheses around theconditional. If you try to use code expressions with interpolating variables, Perlmay surprise you: - $bar = 5;
- $pat = '(?{ 1 })';
- /foo(?{ $bar })bar/; # compiles ok, $bar not interpolated
- /foo(?{ 1 })$bar/; # compile error!
- /foo${pat}bar/; # compile error!
- $pat = qr/(?{ $foo = 1 })/; # precompile code regexp
- /foo${pat}bar/; # compiles ok
If a regexp has (1) code expressions and interpolating variables, or(2) a variable that interpolates a code expression, Perl treats theregexp as an error. If the code expression is precompiled into avariable, however, interpolating is ok. The question is, why is thisan error? The reason is that variable interpolation and code expressionstogether pose a security risk. The combination is dangerous becausemany programmers who write search engines often take user input andplug it directly into a regexp: - $regexp = <> # read user-supplied regexp
- $chomp $regexp; # get rid of possible newline
- $text =~ /$regexp/; # search $text for the $regexp
If the $regexp variable contains a code expression, the user couldthen execute arbitrary Perl code. For instance, some joker couldsearch for system('rm -rf *'); to erase your files. In thissense, the combination of interpolation and code expressions taintsyour regexp. So by default, using both interpolation and codeexpressions in the same regexp is not allowed. If you're notconcerned about malicious users, it is possible to bypass thissecurity check by invoking use re 'eval' : - use re 'eval'; # throw caution out the door
- $bar = 5;
- $pat = '(?{ 1 })';
- /foo(?{ 1 })$bar/; # compiles ok
- /foo${pat}bar/; # compiles ok
Another form of code expression is the pattern code expression.The pattern code expression is like a regular code expression, exceptthat the result of the code evaluation is treated as a regularexpression and matched immediately. A simple example is - $length = 5;
- $char = 'a';
- $x = 'aaaaabb';
- $x =~ /(??{$char x $length})/x; # matches, there are 5 of 'a'
This final example contains both ordinary and pattern codeexpressions. It detects whether a binary string 1101010010001... has aFibonacci spacing 0,1,1,2,3,5,... of the 1 's: - $x = "1101010010001000001";
- $z0 = ''; $z1 = '0'; # initial conditions
- print "It is a Fibonacci sequence\n"
- if $x =~ /^1 # match an initial '1'
- (?:
- ((??{ $z0 })) # match some '0'
- 1 # and then a '1'
- (?{ $z0 = $z1; $z1 .= $^N; })
- )+ # repeat as needed
- $ # that is all there is
- /x;
- printf "Largest sequence matched was %d\n", length($z1)-length($z0);
Remember that $^N is set to whatever was matched by the lastcompleted capture group. This prints - It is a Fibonacci sequence
- Largest sequence matched was 5
Ha! Try that with your garden variety regexp package... Note that the variables $z0 and $z1 are not substituted when theregexp is compiled, as happens for ordinary variables outside a codeexpression. Rather, the code expressions are evaluated when Perlencounters them during the search for a match. The regexp without the //x modifier is - /^1(?:((??{ $z0 }))1(?{ $z0 = $z1; $z1 .= $^N; }))+$/
which shows that spaces are still possible in the code parts. Nevertheless,when working with code and conditional expressions, the extended form ofregexps is almost necessary in creating and debugging regexps. Backtracking control verbsPerl 5.10 introduced a number of control verbs intended to providedetailed control over the backtracking process, by directly influencingthe regexp engine and by providing monitoring techniques. As allthe features in this group are experimental and subject to change orremoval in a future version of Perl, the interested reader isreferred to Special Backtracking Control Verbs in perlre for adetailed description. Below is just one example, illustrating the control verb (*FAIL) ,which may be abbreviated as (*F) . If this is inserted in a regexpit will cause it to fail, just as it would at somemismatch between the pattern and the string. Processingof the regexp continues as it would after any "normal"failure, so that, for instance, the next position in the string or anotheralternative will be tried. As failing to match doesn't preserve capturegroups or produce results, it may be necessary to use this incombination with embedded code. - %count = ();
- "supercalifragilisticexpialidocious" =~
- /([aeiou])(?{ $count{$1}++; })(*FAIL)/i;
- printf "%3d '%s'\n", $count{$_}, $_ for (sort keys %count);
The pattern begins with a class matching a subset of letters. Wheneverthis matches, a statement like $count{'a'}++; is executed, incrementingthe letter's counter. Then (*FAIL) does what it says, andthe regexp engine proceeds according to the book: as long as the end ofthe string hasn't been reached, the position is advanced before lookingfor another vowel. Thus, match or no match makes no difference, and theregexp engine proceeds until the entire string has been inspected.(It's remarkable that an alternative solution using something like - $count{lc($_)}++ for split('', "supercalifragilisticexpialidocious");
- printf "%3d '%s'\n", $count2{$_}, $_ for ( qw{ a e i o u } );
is considerably slower.) Pragmas and debuggingSpeaking of debugging, there are several pragmas available to controland debug regexps in Perl. We have already encountered one pragma inthe previous section, use re 'eval'; , that allows variableinterpolation and code expressions to coexist in a regexp. The otherpragmas are - use re 'taint';
- $tainted = <>
- @parts = ($tainted =~ /(\w+)\s+(\w+)/; # @parts is now tainted
The taint pragma causes any substrings from a match with a taintedvariable to be tainted as well. This is not normally the case, asregexps are often used to extract the safe bits from a taintedvariable. Use taint when you are not extracting safe bits, but areperforming some other processing. Both taint and eval pragmasare lexically scoped, which means they are in effect only untilthe end of the block enclosing the pragmas. - use re '/m'; # or any other flags
- $multiline_string =~ /^foo/; # /m is implied
The re '/flags' pragma (introduced in Perl5.14) turns on the given regular expression flagsuntil the end of the lexical scope. See'/flags' mode in re for moredetail. - use re 'debug';
- /^(.*)$/s; # output debugging info
- use re 'debugcolor';
- /^(.*)$/s; # output debugging info in living color
The global debug and debugcolor pragmas allow one to getdetailed debugging info about regexp compilation andexecution. debugcolor is the same as debug, except the debugginginformation is displayed in color on terminals that can displaytermcap color sequences. Here is example output: - % perl -e 'use re "debug" "abc" =~ /a*b+c/;'
- Compiling REx 'a*b+c'
- size 9 first at 1
- 1: STAR(4)
- 2: EXACT <a>(0)
- 4: PLUS(7)
- 5: EXACT <b>(0)
- 7: EXACT <c>(9)
- 9: END(0)
- floating 'bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx 'a*b+c' against 'abc'...
- Found floating substr 'bc' at offset 1...
- Guessed: match at offset 0
- Matching REx 'a*b+c' against 'abc'
- Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
- EXACT <a> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
- Match successful!
- Freeing REx: 'a*b+c'
If you have gotten this far into the tutorial, you can probably guesswhat the different parts of the debugging output tell you. The firstpart - Compiling REx 'a*b+c'
- size 9 first at 1
- 1: STAR(4)
- 2: EXACT <a>(0)
- 4: PLUS(7)
- 5: EXACT <b>(0)
- 7: EXACT <c>(9)
- 9: END(0)
describes the compilation stage. STAR(4) means that there is astarred object, in this case 'a' , and if it matches, goto line 4,i.e., PLUS(7) . The middle lines describe some heuristics andoptimizations performed before a match: - floating 'bc' at 0..2147483647 (checking floating) minlen 2
- Guessing start of match, REx 'a*b+c' against 'abc'...
- Found floating substr 'bc' at offset 1...
- Guessed: match at offset 0
Then the match is executed and the remaining lines describe theprocess: - Matching REx 'a*b+c' against 'abc'
- Setting an EVAL scope, savestack=3
- 0 <> <abc> | 1: STAR
- EXACT <a> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 1 <a> <bc> | 4: PLUS
- EXACT <b> can match 1 times out of 32767...
- Setting an EVAL scope, savestack=3
- 2 <ab> <c> | 7: EXACT <c>
- 3 <abc> <> | 9: END
- Match successful!
- Freeing REx: 'a*b+c'
Each step is of the form n <x> <y> , with <x> thepart of the string matched and <y> the part not yetmatched. The | 1: STAR says that Perl is at line number 1in the compilation list above. SeeDebugging Regular Expressions in perldebguts for much more detail. An alternative method of debugging regexps is to embed print statements within the regexp. This provides a blow-by-blow account ofthe backtracking in an alternation: - "that this" =~ m@(?{print "Start at position ", pos, "\n"})
- t(?{print "t1\n"})
- h(?{print "h1\n"})
- i(?{print "i1\n"})
- s(?{print "s1\n"})
- |
- t(?{print "t2\n"})
- h(?{print "h2\n"})
- a(?{print "a2\n"})
- t(?{print "t2\n"})
- (?{print "Done at position ", pos, "\n"})
- @x;
prints - Start at position 0
- t1
- h1
- t2
- h2
- a2
- t2
- Done at position 4
BUGSCode expressions, conditional expressions, and independent expressionsare experimental. Don't use them in production code. Yet. SEE ALSOThis is just a tutorial. For the full story on Perl regularexpressions, see the perlre regular expressions reference page. For more information on the matching m// and substitution s/// operators, see Regexp Quote-Like Operators in perlop. Forinformation on the split operation, see split. For an excellent all-around resource on the care and feeding ofregular expressions, see the book Mastering Regular Expressions byJeffrey Friedl (published by O'Reilly, ISBN 1556592-257-3). AUTHOR AND COPYRIGHTCopyright (c) 2000 Mark KvaleAll rights reserved. This document may be distributed under the same terms as Perl itself. AcknowledgmentsThe inspiration for the stop codon DNA example came from the ZIPcode example in chapter 7 of Mastering Regular Expressions. The author would like to thank Jeff Pinyan, Andrew Johnson, PeterHaworth, Ronald J Kimball, and Joe Smith for all their helpfulcomments. |